Orthologous regulated operons containing OB0356 gene
Regulog: | YybR/YdeP - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | HxlR |
Regulation mode: | activator |
Biological process: | Multidrug resistance |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Oceanobacillus iheyensis HTE831 | ||||
Position: -123
Score: 5.61318 Sequence: TAGTATCTTTAAGGAAACTA
Locus tag: OB0355
Name: null Funciton: Putative oxidoreductase
Locus tag: OB0356
Name: null Funciton: FMN reductase (EC 1.5.1.29) |
||||
OB0355-OB0356 | -123 | 5.6 | TAGTATCTTTAAGGAAACTA | OB0355 |