Orthologous regulated operons containing ydeQ gene
| Regulog: | YybR/YdeP - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -95
Score: 6.18055 Sequence: TAGTATACTTTTTGATACTA
Locus tag: BSU05300
Name: ydeQ Funciton: Putative NAD(P)H oxidoreductase |
||||
| ydeQ | -95 | 6.2 | TAGTATACTTTTTGATACTA | BSU05300 |