Orthologous regulated operons containing yfkO gene
| Regulog: | YybR/YdeP - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | activator |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -100
Score: 5.45533 Sequence: CAGTATCAAAATGAATACTA
Locus tag: RBAM_008000
Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
||||
| yfkO | -100 | 5.5 | CAGTATCAAAATGAATACTA | RBAM_008000 |
| Bacillus cereus ATCC 14579 | ||||
|
Position: -107
Score: 6.26811 Sequence: TAGTATCTTTTTTGATACTA
Locus tag: BC3321
Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
||||
| yfkO | -107 | 6.3 | TAGTATCTTTTTTGATACTA | BC3321 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -117
Score: 6.31707 Sequence: TAGTATAAAAAATGATACTA
Locus tag: BLi00813
Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
||||
| yfkO | -117 | 6.3 | TAGTATAAAAAATGATACTA | BLi00813 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -103
Score: 5.96078 Sequence: TGGTATCAAAATTGATACTA
Locus tag: BSU07830
Name: yfkO Funciton: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) |
||||
| yfkO | -103 | 6 | TGGTATCAAAATTGATACTA | BSU07830 |