Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dde_2790 gene

Properties
Regulog: ArsR2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Phylum: Proteobacteria/delta
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -143
Score: 5.58748
Sequence: ATTTTGATGACACTCAAAAT
Locus tag: Dde_2790
Name: null
Funciton: hypothetical protein
Locus tag: Dde_2791
Name: arsB
Funciton: Arsenical-resistance protein ACR3
Locus tag: Dde_2792
Name: arsC-1
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: Dde_2793
Name: arsC-2
Funciton: Arsenate reductase
Dde_2790-arsB-arsC-1-arsC-2 -143 5.6 ATTTTGATGACACTCAAAAT Dde_2790