Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Dret_2261 gene

Properties
Regulog: SmtB - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heavy metal resistance
Effector:
Phylum: Proteobacteria/delta
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -47
Score: 5.65441
Sequence: TAATTGAACAATTGATCAAGCG
Locus tag: Dret_2262
Name: smtB
Funciton: Transcriptional regulator, ArsR family
Locus tag: Dret_2261
Name: null
Funciton: heavy metal translocating P-type ATPase
smtB-Dret_2261 -47 5.7 TAATTGAACAATTGATCAAGCG Dret_2262