Orthologous regulated operons containing metT gene
Regulog: | SahR - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | ArsR |
Regulation mode: | repressor |
Biological process: | Methionine metabolism |
Effector: | S-adenosylhomocysteine |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfovibrio desulfuricans G20 | ||||
Position: -131
Score: 5.72692 Sequence: TTATCAACTTAGTTTGATAT
Locus tag: Dde_2476
Name: metT Funciton: Methionine transporter MetT |
||||
metT | -131 | 5.7 | TTATCAACTTAGTTTGATAT | Dde_2476 |