Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bhmT gene

Properties
Regulog: SahR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Built upon 31 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -102
Score: 6.27377
Sequence: ATATCAAAATATCTTGATAT
Locus tag: Dret_2255
Name: bhmT
Funciton: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
bhmT -102 6.3 ATATCAAAATATCTTGATAT Dret_2255
© 2009-2020 RegPrecise