Orthologous regulated operons containing metE gene
| Regulog: | SahR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -293
Score: 4.43642 Sequence: ATATTGATGAATCTTGATAT
Locus tag: Dde_2328
Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
||||
| metE | -293 | 4.4 | ATATTGATGAATCTTGATAT | Dde_2328 |
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -282
Score: 4.80508 Sequence: ATATAACAATATTTTTATAT
Position: -274
Score: 4.2127 Sequence: ATATTTTTATATATTGAATT
Locus tag: Desal_0813
Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: Desal_0814
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metE-metF | -282 | 4.8 | ATATAACAATATTTTTATAT | Desal_0813 |
| -274 | 4.2 | ATATTTTTATATATTGAATT | ||
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -341
Score: 5.33619 Sequence: ATATCAGTATTTCCTGATGT
Locus tag: DVU3371
Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14) |
||||
| metE | -341 | 5.3 | ATATCAGTATTTCCTGATGT | DVU3371 |