Orthologous regulated operons containing metF gene
| Regulog: | SahR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -69
Score: 4.48738 Sequence: ATATTACAATAGGTCGATAT
Position: -45
Score: 6.20848 Sequence: ATATAAGGCTATCTTGATAT
Locus tag: Dde_2525
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metF | -69 | 4.5 | ATATTACAATAGGTCGATAT | Dde_2525 |
| -45 | 6.2 | ATATAAGGCTATCTTGATAT | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||||
|
Position: -80
Score: 6.46068 Sequence: ATATCAATTTATCTTGATAT
Locus tag: Ddes_2008
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metF | -80 | 6.5 | ATATCAATTTATCTTGATAT | Ddes_2008 |
| Desulfovibrio piger ATCC 29098 | ||||
|
Position: -73
Score: 6.23645 Sequence: TTATCAAGTTATATTGATAT
Locus tag: DESPIG_02490
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metF | -73 | 6.2 | TTATCAAGTTATATTGATAT | DESPIG_02490 |
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -282
Score: 4.80508 Sequence: ATATAACAATATTTTTATAT
Position: -274
Score: 4.2127 Sequence: ATATTTTTATATATTGAATT
Locus tag: Desal_0813
Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: Desal_0814
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metE-metF | -282 | 4.8 | ATATAACAATATTTTTATAT | Desal_0813 |
| -274 | 4.2 | ATATTTTTATATATTGAATT | ||
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -87
Score: 6.39736 Sequence: ATATCAATCTATCTTGATAT
Locus tag: DVU0997
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metF | -87 | 6.4 | ATATCAATCTATCTTGATAT | DVU0997 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -208
Score: 6.57713 Sequence: ATATCAAGATAGCTTGATAT
Locus tag: DvMF_3034
Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) |
||||
| metF | -208 | 6.6 | ATATCAAGATAGCTTGATAT | DvMF_3034 |