Orthologous regulated operons containing sahR gene
| Regulog: | SahR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Methionine metabolism |
| Effector: | S-adenosylhomocysteine |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||||
|
Position: -172
Score: 4.7259 Sequence: TTATCAACTTTTTCAGATAT
Locus tag: Dret_2302
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dret_2301
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
Locus tag: Dret_2300
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| sahR-ahcY-metK | -172 | 4.7 | TTATCAACTTTTTCAGATAT | Dret_2302 |
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -45
Score: 6.71464 Sequence: ATATCAGGATATCTTGATAT
Locus tag: Dbac_2305
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dbac_2304
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
Locus tag: Dbac_2303
Name: metK Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6) |
||||
| sahR-ahcY-metK | -45 | 6.7 | ATATCAGGATATCTTGATAT | Dbac_2305 |
| Desulfovibrio desulfuricans G20 | ||||
|
Position: 63
Score: 5.34113 Sequence: ACATCAACTTTTCTTGATTC
Locus tag: Dde_3135
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Dde_3134
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | 63 | 5.3 | ACATCAACTTTTCTTGATTC | Dde_3135 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||||
|
Position: -57
Score: 5.37803 Sequence: ATATGCGGATAACTTGATAC
Position: -35
Score: 5.01252 Sequence: GTATCAGCATAAATTGATTT
Locus tag: Ddes_0040
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Ddes_0039
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -57 | 5.4 | ATATGCGGATAACTTGATAC | Ddes_0040 |
| -35 | 5 | GTATCAGCATAAATTGATTT | ||
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -18
Score: 6.71464 Sequence: ATATCAGGATATCTTGATAT
Locus tag: DMR_43430
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: DMR_43440
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -18 | 6.7 | ATATCAGGATATCTTGATAT | DMR_43430 |
| Desulfovibrio piger ATCC 29098 | ||||
|
Position: -83
Score: 5.80101 Sequence: ATATCCAGATAGGCTGATAT
Position: -61
Score: 4.05588 Sequence: GCATCAAGCAAATTTGATAC
Locus tag: DESPIG_01931
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: DESPIG_01930
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -83 | 5.8 | ATATCCAGATAGGCTGATAT | DESPIG_01931 |
| -61 | 4.1 | GCATCAAGCAAATTTGATAC | ||
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -39
Score: 3.72898 Sequence: ATATAAAGGTTTTGTTATGT
Locus tag: Desal_3078
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: Desal_3077
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -39 | 3.7 | ATATAAAGGTTTTGTTATGT | Desal_3078 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -52
Score: 5.91394 Sequence: ACATCAAGTTTTCTTGATTT
Locus tag: DVU0606
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: DVU0607
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -52 | 5.9 | ACATCAAGTTTTCTTGATTT | DVU0606 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -103
Score: 5.30723 Sequence: AAATCAAGTTTTCTTGATGT
Locus tag: DvMF_2579
Name: sahR Funciton: Predicted regulator of methionine metabolism, ArsR family
Locus tag: DvMF_2580
Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1) |
||||
| sahR-ahcY | -103 | 5.3 | AAATCAAGTTTTCTTGATGT | DvMF_2579 |