Orthologous regulated operons containing araN gene

Properties
Regulog:	AraR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Phylum:	Firmicutes

Built upon 43 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -99 Score: 5.83127 Sequence: AAAATTGTTCGTACAAATAA Position: -57 Score: 5.26869 Sequence: ATATTCGTACGTATATTTTT Locus tag: RBAM_025860 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: RBAM_025850 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: RBAM_025840 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: RBAM_025830 Name: araL Funciton: L-arabinose utilization protein Locus tag: RBAM_025820 Name: egsA Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261) Locus tag: RBAM_025810 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein Locus tag: RBAM_025800 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: RBAM_025790 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: RBAM_025780 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA	-99	5.8	AAAATTGTTCGTACAAATAA	RBAM_025860
	-57	5.3	ATATTCGTACGTATATTTTT
Bacillus halodurans C-125
Position: -49 Score: 4.42753 Sequence: AAACGTGTACGTACACGATA Locus tag: BH0902 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: BH0903 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: BH0904 Name: yteU Funciton: Predicted integral membrane protein Locus tag: BH0905 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein
araP-araQ-yteU-araN	-49	4.4	AAACGTGTACGTACACGATA	BH0902
Bacillus licheniformis DSM 13
Position: -155 Score: 5.15606 Sequence: GAAGTTGTTCGTACAAATAT Position: -125 Score: 5.71286 Sequence: TTAGTTGTACGTACATATAA Locus tag: BLi03028 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BLi03027 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: BLi03026 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BLi03025 Name: egsA Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261) Locus tag: BLi03024 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein Locus tag: BLi03023 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: BLi03022 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: BLi03021 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-egsA-araN-araP-araQ-abfA	-155	5.2	GAAGTTGTTCGTACAAATAT	BLi03028
	-125	5.7	TTAGTTGTACGTACATATAA
Bacillus subtilis subsp. subtilis str. 168
Position: -103 Score: 5.853 Sequence: AAAATTGTTCGTACAAATAT Locus tag: BSU28800 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BSU28790 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: BSU28780 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BSU28770 Name: araL Funciton: L-arabinose utilization protein Locus tag: BSU28760 Name: egsA Funciton: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261) Locus tag: BSU28750 Name: araN Funciton: Alpha-arabinosides ABC transport system, substrate-binding protein Locus tag: BSU28740 Name: araP Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: BSU28730 Name: araQ Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: BSU28720 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araA-araB-araD-araL-egsA-araN-araP-araQ-abfA	-103	5.9	AAAATTGTTCGTACAAATAT	BSU28800