Orthologous regulated operons containing araR gene
| Regulog: | AraR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anoxybacillus flavithermus WK1 | ||||
|
Position: -81
Score: 5.87614 Sequence: AAATATATACGTACAAATAA
Locus tag: Aflv_0528
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -81 | 5.9 | AAATATATACGTACAAATAA | Aflv_0528 |
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -167
Score: 5.58152 Sequence: ACATTTGTACGTACTTATGA
Position: -124
Score: 5.40942 Sequence: AAATTAGTACGCACAAATAA
Locus tag: RBAM_031330
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -167 | 5.6 | ACATTTGTACGTACTTATGA | RBAM_031330 |
| -124 | 5.4 | AAATTAGTACGCACAAATAA | ||
| Bacillus halodurans C-125 | ||||
|
Position: -36
Score: 5.22018 Sequence: TCATTTGTACGTATAAGTTG
Locus tag: BH1875
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -36 | 5.2 | TCATTTGTACGTATAAGTTG | BH1875 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -192
Score: 5.78504 Sequence: TTTTTTGTACGTACATATGT
Position: -160
Score: 5.03828 Sequence: TAATATGTTCATATAAATAT
Locus tag: BLi02061
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -192 | 5.8 | TTTTTTGTACGTACATATGT | BLi02061 |
| -160 | 5 | TAATATGTTCATATAAATAT | ||
| Bacillus pumilus SAFR-032 | ||||
|
Position: -191
Score: 6.06043 Sequence: ATATTTGTACGTACATATGT
Locus tag: BPUM_2330
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -191 | 6.1 | ATATTTGTACGTACATATGT | BPUM_2330 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -91
Score: 5.4564 Sequence: TCAATTGTACGTACTTATAT
Position: -48
Score: 6.00642 Sequence: TAATTAGTACGTACAAATAT
Locus tag: BSU33970
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -91 | 5.5 | TCAATTGTACGTACTTATAT | BSU33970 |
| -48 | 6 | TAATTAGTACGTACAAATAT | ||
| Geobacillus kaustophilus HTA426 | ||||
|
Position: -75
Score: 4.96238 Sequence: ATAATGATACGGACAAATAA
Locus tag: GK1907
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -75 | 5 | ATAATGATACGGACAAATAA | GK1907 |
| Oceanobacillus iheyensis HTE831 | ||||
|
Position: -203
Score: 5.38375 Sequence: ATTATTGTACGTACATTTGT
Position: -170
Score: 5.87614 Sequence: ATATATATACGTACAAATTA
Position: -63
Score: 5.27937 Sequence: AAATATGTACATACAAGTAT
Locus tag: OB2800
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araR | -203 | 5.4 | ATTATTGTACGTACATTTGT | OB2800 |
| -170 | 5.9 | ATATATATACGTACAAATTA | ||
| -63 | 5.3 | AAATATGTACATACAAGTAT | ||
| Paenibacillus sp. JDR-2 | ||||
|
Position: -100
Score: 4.75903 Sequence: TCACATGTACATACAAGTTA
Locus tag: Pjdr2_4209
Name: araK Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Pjdr2_4208
Name: araR Funciton: Transcriptional repressor of arabinoside utilization, GntR family |
||||
| araK-araR | -100 | 4.8 | TCACATGTACATACAAGTTA | Pjdr2_4209 |