Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing araH gene

Properties
Regulog: AraR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 43 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Geobacillus kaustophilus HTA426
Position: -36
Score: 5.66463
Sequence: TTAAATATACGTACAAATTT
Locus tag: GK1910
Name: araF
Funciton: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
Locus tag: GK1909
Name: araG
Funciton: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
Locus tag: GK1908
Name: araH
Funciton: L-arabinose transport system permease protein (TC 3.A.1.2.2)
araF-araG-araH -36 5.7 TTAAATATACGTACAAATTT GK1910
© 2009-2020 RegPrecise