Orthologous regulated operons containing abnA gene
| Regulog: | AraR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -105
Score: 5.17601 Sequence: TTTTTTGTCTGTACAAATAT
Locus tag: RBAM_025870
Name: abnA Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99) |
||||
| abnA | -105 | 5.2 | TTTTTTGTCTGTACAAATAT | RBAM_025870 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -159
Score: 5.18073 Sequence: TTTTTTGTCTGTACAAATTA
Locus tag: BSU28810
Name: abnA Funciton: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99) |
||||
| abnA | -159 | 5.2 | TTTTTTGTCTGTACAAATTA | BSU28810 |