Orthologous regulated operons containing yaiA gene
| Regulog: | TrpR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -136
Score: 5.3631 Sequence: TGTACTAGTTTGGTGGTATG
Locus tag: CKO_02783
Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71)
Locus tag: CKO_02782
Name: yaiA Funciton: putative cytoplasmic protein
Locus tag: CKO_02781
Name: aroM Funciton: AroM family protein |
||||
| aroL-yaiA-aroM | -136 | 5.4 | TGTACTAGTTTGGTGGTATG | CKO_02783 |
| Enterobacter sp. 638 | ||||
|
Position: -80
Score: 5.59154 Sequence: CGTACTAGTTTAATGGTATT
Locus tag: Ent638_0859
Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71)
Locus tag: Ent638_0860
Name: yaiA Funciton: putative cytoplasmic protein
Locus tag: Ent638_0861
Name: aroM Funciton: AroM family protein |
||||
| aroL-yaiA-aroM | -80 | 5.6 | CGTACTAGTTTAATGGTATT | Ent638_0859 |
| Escherichia coli str. K-12 substr. MG1655 | ||||
|
Position: -79
Score: 5.64778 Sequence: TGTACTAGTTTGATGGTATG
Locus tag: b0388
Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71)
Locus tag: b0389
Name: yaiA Funciton: putative cytoplasmic protein
Locus tag: b0390
Name: aroM Funciton: AroM family protein |
||||
| aroL-yaiA-aroM | -79 | 5.6 | TGTACTAGTTTGATGGTATG | b0388 |
| Salmonella typhimurium LT2 | ||||
|
Position: -79
Score: 5.12954 Sequence: TGTACTAGTTAGATGATATG
Locus tag: STM0388
Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71)
Locus tag: STM0389
Name: yaiA Funciton: putative cytoplasmic protein
Locus tag: STM0390
Name: aroM Funciton: AroM family protein |
||||
| aroL-yaiA-aroM | -79 | 5.1 | TGTACTAGTTAGATGATATG | STM0388 |