Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing TM0763 gene

Properties
Regulog: TM0766 - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Phylum: Thermotogae
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Fervidobacterium nodosum Rt17-B1
Position: -68
Score: 7.29939
Sequence: CTGTAATAGTACAATATTACAG
Locus tag: Fnod_0429
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: Fnod_0428
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: Fnod_0427
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: Fnod_0426
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-TM0763 -68 7.3 CTGTAATAGTACAATATTACAG Fnod_0429
Thermosipho melanesiensis BI429
Position: -54
Score: 7.52062
Sequence: CTGTAATAGTATAATATTACAG
Locus tag: Tmel_1133
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: Tmel_1132
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: Tmel_1131
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: Tmel_1130
Name: null
Funciton: hypothetical protein
Locus tag: Tmel_1129
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-Tmel_1130-TM0763 -54 7.5 CTGTAATAGTATAATATTACAG Tmel_1133
Thermotoga maritima MSB8
Position: -36
Score: 7.38661
Sequence: GTGTAATAGTATAATATTACAG
Locus tag: TM0766
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: TM0765
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: TM0764
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: TM0763
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-TM0763 -36 7.4 GTGTAATAGTATAATATTACAG TM0766
Thermotoga naphthophila RKU-10
Position: -35
Score: 7.38661
Sequence: GTGTAATAGTATAATATTACAG
Locus tag: Tnap_0564
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: Tnap_0563
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: Tnap_0562
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: Tnap_0561
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-TM0763 -35 7.4 GTGTAATAGTATAATATTACAG Tnap_0564
Thermotoga petrophila RKU-1
Position: -35
Score: 7.38661
Sequence: GTGTAATAGTATAATATTACAG
Locus tag: Tpet_0162
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: Tpet_0163
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: Tpet_0164
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: Tpet_0165
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-TM0763 -35 7.4 GTGTAATAGTATAATATTACAG Tpet_0162
Thermotoga sp. RQ2
Position: -35
Score: 7.38661
Sequence: GTGTAATAGTATAATATTACAG
Locus tag: TRQ2_0160
Name: TM0766
Funciton: hypothetical regulator TM0766, GntR family
Locus tag: TRQ2_0161
Name: TM0765
Funciton: hypothetical ABC transporter, ATP-binding protein
Locus tag: TRQ2_0162
Name: TM0764
Funciton: Hypothetical ABC transporter, permease protein
Locus tag: TRQ2_0163
Name: TM0763
Funciton: protein of unknown function DUF74
TM0766-TM0765-TM0764-TM0763 -35 7.4 GTGTAATAGTATAATATTACAG TRQ2_0160