Orthologous regulated operons containing TM1852 gene
| Regulog: | UgpR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Possibly alpha-mannosides utilization |
| Effector: | |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermosipho melanesiensis BI429 | ||||
|
Position: -34
Score: 6.22045 Sequence: AATTGTAAACGCTTACAAAG
Locus tag: Tmel_0763
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tmel_0764
Name: TM1852 Funciton: Predicted glycosylase, COG2152
Locus tag: Tmel_0765
Name: aglA Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| ugpR-TM1852-aglA | -34 | 6.2 | AATTGTAAACGCTTACAAAG | Tmel_0763 |
| Thermotoga lettingae TMO | ||||
|
Position: -208
Score: 5.92099 Sequence: TTATGGAAACGATTACATAT
Position: -32
Score: 5.93414 Sequence: ATATGAAAAGGATTACACAA
Locus tag: Tlet_1033
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tlet_1032
Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: Tlet_1031
Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: Tlet_1030
Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: Tlet_1029
Name: TM1852 Funciton: Predicted glycosylase, COG2152 |
||||
| ugpR-ugpE-ugpF-ugpG-TM1852 | -208 | 5.9 | TTATGGAAACGATTACATAT | Tlet_1033 |
| -32 | 5.9 | ATATGAAAAGGATTACACAA | ||
| Thermotoga maritima MSB8 | ||||
|
Position: -30
Score: 6.53723 Sequence: ATATGTAAGCGCTTACAGGA
Locus tag: TM1856
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: TM1855
Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: TM1854
Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: TM1853
Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: TM1852
Name: TM1852 Funciton: Predicted glycosylase, COG2152
Locus tag: TM1851
Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24) |
||||
| ugpR-ugpE-ugpF-ugpG-TM1852-mnnA | -30 | 6.5 | ATATGTAAGCGCTTACAGGA | TM1856 |
| Thermotoga naphthophila RKU-10 | ||||
|
Position: -30
Score: 6.53723 Sequence: ATATGTAAGCGCTTACAGGA
Locus tag: Tnap_0613
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tnap_0612
Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: Tnap_0611
Name: Tpet_0943 Funciton: conserved hypothetical protein
Locus tag: Tnap_0610
Name: Tpet_0944 Funciton: glycosyl transferase group 1
Locus tag: Tnap_0609
Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: Tnap_0608
Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: Tnap_0607
Name: TM1852 Funciton: Predicted glycosylase, COG2152
Locus tag: Tnap_0606
Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24) |
||||
| ugpR-ugpE-Tpet_0943-Tpet_0944-ugpF-ugpG-TM1852-mnnA | -30 | 6.5 | ATATGTAAGCGCTTACAGGA | Tnap_0613 |
| Thermotoga neapolitana DSM 4359 | ||||
|
Position: -30
Score: 6.23778 Sequence: TTATGTAAGCGCTTACAGGA
Locus tag: CTN_0791
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: CTN_0790
Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: CTN_0789
Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: CTN_0788
Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: CTN_0787
Name: TM1852 Funciton: Predicted glycosylase, COG2152
Locus tag: CTN_0786
Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24) |
||||
| ugpR-ugpE-ugpF-ugpG-TM1852-mnnA | -30 | 6.2 | TTATGTAAGCGCTTACAGGA | CTN_0791 |
| Thermotoga petrophila RKU-1 | ||||
|
Position: -30
Score: 6.53723 Sequence: ATATGTAAGCGCTTACAGGA
Locus tag: Tpet_0941
Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tpet_0942
Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: Tpet_0943
Name: Tpet_0943 Funciton: conserved hypothetical protein
Locus tag: Tpet_0944
Name: Tpet_0944 Funciton: glycosyl transferase group 1
Locus tag: Tpet_0945
Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: Tpet_0946
Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: Tpet_0947
Name: TM1852 Funciton: Predicted glycosylase, COG2152
Locus tag: Tpet_0948
Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24) |
||||
| ugpR-ugpE-Tpet_0943-Tpet_0944-ugpF-ugpG-TM1852-mnnA | -30 | 6.5 | ATATGTAAGCGCTTACAGGA | Tpet_0941 |