Orthologous regulated operons containing conA1 gene
| Regulog: | AraR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga petrophila RKU-1 | ||||
|
Position: -221
Score: 5.74643 Sequence: AGATAGGTACGTACCAATTT
Position: -38
Score: 5.35162 Sequence: ATATATGTACGTACAAAATG
Locus tag: Tpet_0637
Name: abf6 Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0638
Name: lamG1 Funciton: Laminin G domain-containing protein
Locus tag: Tpet_0639
Name: abf6 Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0640
Name: conA1 Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0641
Name: conA2 Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0642
Name: lamG2 Funciton: Laminin G domain-containing protein |
||||
| abf6-lamG1-abf6-conA1-conA2-lamG2 | -221 | 5.7 | AGATAGGTACGTACCAATTT | Tpet_0637 |
| -38 | 5.4 | ATATATGTACGTACAAAATG | ||
| Thermotoga sp. RQ2 | ||||
|
Position: -221
Score: 5.74643 Sequence: AGATAGGTACGTACCAATTT
Position: -38
Score: 5.35162 Sequence: ATATATGTACGTACAAAATG
Locus tag: TRQ2_0662
Name: abf6 Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: TRQ2_0663
Name: lamG1 Funciton: Laminin G domain-containing protein
Locus tag: TRQ2_0664
Name: abf6 Funciton: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: TRQ2_0665
Name: conA1 Funciton: Con A-like domain-containing protein
Locus tag: TRQ2_0666
Name: conA2 Funciton: Con A-like domain-containing protein
Locus tag: TRQ2_0667
Name: lamG2 Funciton: Laminin G domain-containing protein |
||||
| abf6-lamG1-abf6-conA1-conA2-lamG2 | -221 | 5.7 | AGATAGGTACGTACCAATTT | TRQ2_0662 |
| -38 | 5.4 | ATATATGTACGTACAAAATG | ||