Orthologous regulated operons containing araG gene
| Regulog: | AraR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga maritima MSB8 | ||||
|
Position: -1498
Score: 6.28709 Sequence: ATAAAaGTACGTACCaTTAT
Position: -1396
Score: 4.7066 Sequence: ccAtcGGTACGTACCgTTAT
Locus tag: TM0278
Name: araF Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TM0279
Name: araG Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
||||
| araF-araG | -1498 | 6.3 | ATAAAaGTACGTACCaTTAT | TM0278 |
| -1396 | 4.7 | ccAtcGGTACGTACCgTTAT | ||
| Thermotoga petrophila RKU-1 | ||||
|
Position: -150
Score: 6.51559 Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7066 Sequence: CCATCGGTACGTACCGTTAT
Locus tag: Tpet_0647
Name: araE Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0646
Name: araE Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0645
Name: araF Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: Tpet_0644
Name: araG Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
||||
| araE-araE-araF-araG | -150 | 6.5 | ATAAAAGTACGTACCTTTAT | Tpet_0647 |
| -48 | 4.7 | CCATCGGTACGTACCGTTAT | ||
| Thermotoga sp. RQ2 | ||||
|
Position: -150
Score: 6.51559 Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7066 Sequence: CCATCGGTACGTACCGTTAT
Locus tag: TRQ2_0671
Name: araE Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: TRQ2_0670
Name: araF Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TRQ2_0669
Name: araG Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
||||
| araE-araF-araG | -150 | 6.5 | ATAAAAGTACGTACCTTTAT | TRQ2_0671 |
| -48 | 4.7 | CCATCGGTACGTACCGTTAT | ||