Orthologous regulated operons containing xylX gene
| Regulog: | AraR - Thermotogales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Thermotogae |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Thermotoga petrophila RKU-1 | ||||
|
Position: -233
Score: 5.35162 Sequence: CATTTTGTACGTACATATAT
Position: -50
Score: 5.74643 Sequence: AAATTGGTACGTACCTATCT
Locus tag: Tpet_0636
Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tpet_0635
Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tpet_0634
Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tpet_0633
Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
Locus tag: Tpet_0632
Name: xylX Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: Tpet_0631
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tpet_0630
Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tpet_0629
Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Tpet_0628
Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Tpet_0627
Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
||||
| araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW | -233 | 5.4 | CATTTTGTACGTACATATAT | Tpet_0636 |
| -50 | 5.7 | AAATTGGTACGTACCTATCT | ||
| Thermotoga sp. RQ2 | ||||
|
Position: -233
Score: 5.35162 Sequence: CATTTTGTACGTACATATAT
Position: -50
Score: 5.74643 Sequence: AAATTGGTACGTACCTATCT
Locus tag: TRQ2_0661
Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: TRQ2_0660
Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: TRQ2_0659
Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: TRQ2_0658
Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
Locus tag: TRQ2_0657
Name: xylX Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: TRQ2_0656
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: TRQ2_0655
Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: TRQ2_0654
Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: TRQ2_0653
Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: TRQ2_0652
Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
||||
| araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW | -233 | 5.4 | CATTTTGTACGTACATATAT | TRQ2_0661 |
| -50 | 5.7 | AAATTGGTACGTACCTATCT | ||