Orthologous regulated operons containing araB gene

Properties
Regulog:	AraR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Phylum:	Thermotogae

Built upon 35 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -169 Score: 4.99913 Sequence: TAATTTGTATGTACATATAT Locus tag: Tlet_1143 Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein Locus tag: Tlet_1144 Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: Tlet_1145 Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: Tlet_1146 Name: xynB Funciton: Endo-1,4-beta-xylanase Locus tag: Tlet_1147 Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) Locus tag: Tlet_1148 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: Tlet_1149 Name: araA-II Funciton: Predicted L-arabinose isomerase (EC 5.3.1.4) Locus tag: Tlet_1150 Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
araN-II-araP-II-araQ-II-xynB-abf3-abfA-araA-II-araB	-169	5	TAATTTGTATGTACATATAT	Tlet_1143
Thermotoga maritima MSB8
Position: -44 Score: 5.93951 Sequence: AATAATGTACGTACCTAAAT Locus tag: TM0280 Name: glsA Funciton: Putative glycosyl hydrolase of unknown function (DUF1680) Locus tag: TM0281 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: TM0282 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: TM0283 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: TM0284 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: TM0285 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA-abfA-araM-araD-araB-araW	-44	5.9	AATAATGTACGTACCTAAAT	TM0280
Thermotoga naphthophila RKU-10
Position: -56 Score: 4.89355 Sequence: TATAATGTACGTACCTATCA Position: -55 Score: 5.03261 Sequence: GATAATATACGTACCTAAAT Locus tag: Tnap_0910 Name: glsA Funciton: Putative glycosyl hydrolase of unknown function (DUF1680) Locus tag: Tnap_0911 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: Tnap_0912 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: Tnap_0913 Name: Tnap_0913 Funciton: predicted arabinose ABC transporter, sugar-binding protein Locus tag: Tnap_0914 Name: Tnap_0914 Funciton: predicted arabinose ABC transporter, permease component Locus tag: Tnap_0915 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: Tnap_0916 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: Tnap_0917 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA-abfA-araM-Tnap_0913-Tnap_0914-araD-araB-araW	-56	4.9	TATAATGTACGTACCTATCA	Tnap_0910
	-55	5	GATAATATACGTACCTAAAT
Thermotoga petrophila RKU-1
Position: -233 Score: 5.35162 Sequence: CATTTTGTACGTACATATAT Position: -50 Score: 5.74643 Sequence: AAATTGGTACGTACCTATCT Locus tag: Tpet_0636 Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein Locus tag: Tpet_0635 Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: Tpet_0634 Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: Tpet_0633 Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) Locus tag: Tpet_0632 Name: xylX Funciton: Secreted glycosyl hydrolase, similar to xylosidase Locus tag: Tpet_0631 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: Tpet_0630 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: Tpet_0629 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: Tpet_0628 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: Tpet_0627 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW	-233	5.4	CATTTTGTACGTACATATAT	Tpet_0636
	-50	5.7	AAATTGGTACGTACCTATCT
Thermotoga sp. RQ2
Position: -233 Score: 5.35162 Sequence: CATTTTGTACGTACATATAT Position: -50 Score: 5.74643 Sequence: AAATTGGTACGTACCTATCT Locus tag: TRQ2_0661 Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein Locus tag: TRQ2_0660 Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: TRQ2_0659 Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: TRQ2_0658 Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) Locus tag: TRQ2_0657 Name: xylX Funciton: Secreted glycosyl hydrolase, similar to xylosidase Locus tag: TRQ2_0656 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: TRQ2_0655 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: TRQ2_0654 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: TRQ2_0653 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: TRQ2_0652 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW	-233	5.4	CATTTTGTACGTACATATAT	TRQ2_0661
	-50	5.7	AAATTGGTACGTACCTATCT