Orthologous regulated operons containing susG gene
| Regulog: | MalR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides eggerthii DSM 20697 | ||||
|
Position: -351
Score: 5.61926 Sequence: AAGTGCAAACGATTGCAGGA
Position: -198
Score: 5.42881 Sequence: TGATGCAATCGTTTGCGCTC
Locus tag: BACEGG_01900
Name: susC Funciton: SusC, outer membrane protein involved in starch binding
Locus tag: BACEGG_01901
Name: susD Funciton: SusD, outer membrane protein
Locus tag: BACEGG_01902
Name: SusE Funciton: Outer membrane protein SusE
Locus tag: BACEGG_01903
Name: susG Funciton: Alpha-amylase SusG (EC 3.2.1.1) |
||||
| susC-susD-SusE-susG | -351 | 5.6 | AAGTGCAAACGATTGCAGGA | BACEGG_01900 |
| -198 | 5.4 | TGATGCAATCGTTTGCGCTC | ||
| Bacteroides stercoris ATCC 43183 | ||||
|
Position: -190
Score: 5.85005 Sequence: TAGTGCAATCGTTTGCATTC
Locus tag: BACSTE_01657
Name: susC Funciton: SusC, outer membrane protein involved in starch binding
Locus tag: BACSTE_01658
Name: susD Funciton: SusD, outer membrane protein
Locus tag: BACSTE_01659
Name: SusE Funciton: Outer membrane protein SusE
Locus tag: BACSTE_01660
Name: susF Funciton: Outer membrane protein SusF
Locus tag: BACSTE_01661
Name: susG Funciton: Alpha-amylase SusG (EC 3.2.1.1) |
||||
| susC-susD-SusE-susF-susG | -190 | 5.9 | TAGTGCAATCGTTTGCATTC | BACSTE_01657 |