Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF00128 gene

Properties
Regulog: MalR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization
Effector: Maltose
Phylum: Bacteroidetes
Built upon 30 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -184
Score: 5.65828
Sequence: CTGTGCAATCGTTTGCACTG
Locus tag: BACCELL_05446
Name: susC
Funciton: SusC, outer membrane protein involved in starch binding
Locus tag: BACCELL_05445
Name: susD
Funciton: SusD, outer membrane protein
Locus tag: BACCELL_05444
Name: SusE
Funciton: Outer membrane protein SusE
Locus tag: BACCELL_05443
Name: susF
Funciton: Outer membrane protein SusF
Locus tag: BACCELL_05442
Name: COG3867
Funciton: Arabinogalactan endo-1,4-beta-galactosidase
Locus tag: BACCELL_05441
Name: PF00128
Funciton: Glycosyl hydrolase, family 13, catalytic domain
susC-susD-SusE-susF-COG3867-PF00128 -184 5.7 CTGTGCAATCGTTTGCACTG BACCELL_05446
© 2009-2020 RegPrecise