Orthologous regulated operons containing COG3867 gene
| Regulog: | MalR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||||
|
Position: -184
Score: 5.65828 Sequence: CTGTGCAATCGTTTGCACTG
Locus tag: BACCELL_05446
Name: susC Funciton: SusC, outer membrane protein involved in starch binding
Locus tag: BACCELL_05445
Name: susD Funciton: SusD, outer membrane protein
Locus tag: BACCELL_05444
Name: SusE Funciton: Outer membrane protein SusE
Locus tag: BACCELL_05443
Name: susF Funciton: Outer membrane protein SusF
Locus tag: BACCELL_05442
Name: COG3867 Funciton: Arabinogalactan endo-1,4-beta-galactosidase
Locus tag: BACCELL_05441
Name: PF00128 Funciton: Glycosyl hydrolase, family 13, catalytic domain |
||||
| susC-susD-SusE-susF-COG3867-PF00128 | -184 | 5.7 | CTGTGCAATCGTTTGCACTG | BACCELL_05446 |