Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susD gene

Properties
Regulog: MalR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization
Effector: Maltose
Phylum: Bacteroidetes
Built upon 30 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides fragilis NCTC 9343
Position: -172
Score: 5.56417
Sequence: TGATGCAATCGTTTGCGGAG
Locus tag: BF3146
Name: susC
Funciton: TonB-dependent outer membrane transporter of maltooligosaccharides
Locus tag: BF3145
Name: susD
Funciton: SusD, outer membrane protein
Locus tag: BF3144
Name: BF3144
Funciton: hypothetical protein
Locus tag: BF3143
Name: glgB
Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
susC-susD-BF3144-glgB -172 5.6 TGATGCAATCGTTTGCGGAG BF3146
© 2009-2020 RegPrecise