Orthologous regulated operons containing glgB gene
| Regulog: | MalR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||||
|
Position: -105
Score: 5.79827 Sequence: TCATGCAACCGTTTGCATTA
Locus tag: BACCELL_05433
Name: glgB Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
Locus tag: BACCELL_05432
Name: COG3408 Funciton: Glycogen debranching enzyme |
||||
| glgB-COG3408 | -105 | 5.8 | TCATGCAACCGTTTGCATTA | BACCELL_05433 |
| Bacteroides fragilis NCTC 9343 | ||||
|
Position: -172
Score: 5.56417 Sequence: TGATGCAATCGTTTGCGGAG
Locus tag: BF3146
Name: susC Funciton: TonB-dependent outer membrane transporter of maltooligosaccharides
Locus tag: BF3145
Name: susD Funciton: SusD, outer membrane protein
Locus tag: BF3144
Name: BF3144 Funciton: hypothetical protein
Locus tag: BF3143
Name: glgB Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
||||
| susC-susD-BF3144-glgB | -172 | 5.6 | TGATGCAATCGTTTGCGGAG | BF3146 |
| Bacteroides uniformis ATCC 8492 | ||||
|
Position: -108
Score: 5.73018 Sequence: ATATGCAAACGTTTTCGTGA
Locus tag: BACUNI_01214
Name: glgB Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) |
||||
| glgB | -108 | 5.7 | ATATGCAAACGTTTTCGTGA | BACUNI_01214 |