Orthologous regulated operons containing BACEGG_00186 gene
| Regulog: | MalR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides eggerthii DSM 20697 | ||||
|
Position: -121
Score: 5.70713 Sequence: AAGAGCAAACGTTTGCATAG
Locus tag: BACEGG_00187
Name: dpe Funciton: 4-alpha-glucanotransferase (Amylomaltase) (EC 2.4.1.25)
Locus tag: BACEGG_00186
Name: null Funciton: hypothetical protein |
||||
| dpe-BACEGG_00186 | -121 | 5.7 | AAGAGCAAACGTTTGCATAG | BACEGG_00187 |