Orthologous regulated operons containing malR gene
| Regulog: | MalR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||||
|
Position: -2
Score: 5.61535 Sequence: GTTTGCAAACGTTTGCGCAA
Locus tag: BACCELL_05464
Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family
Locus tag: BACCELL_05465
Name: malP Funciton: Predicted maltose transporter, GPH family |
||||
| malR-malP | -2 | 5.6 | GTTTGCAAACGTTTGCGCAA | BACCELL_05464 |
| Bacteroides eggerthii DSM 20697 | ||||
|
Position: -322
Score: 5.42881 Sequence: GAGCGCAAACGATTGCATCA
Position: -169
Score: 5.61926 Sequence: TCCTGCAATCGTTTGCACTT
Locus tag: BACEGG_01899
Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family
Locus tag: BACEGG_01898
Name: malP Funciton: Predicted maltose transporter, GPH family |
||||
| malR-malP | -322 | 5.4 | GAGCGCAAACGATTGCATCA | BACEGG_01899 |
| -169 | 5.6 | TCCTGCAATCGTTTGCACTT | ||
| Bacteroides fragilis NCTC 9343 | ||||
|
Position: -163
Score: 5.56417 Sequence: CTCCGCAAACGATTGCATCA
Locus tag: BF3147
Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family
Locus tag: BF3148
Name: malP Funciton: Predicted maltose transporter, GPH family |
||||
| malR-malP | -163 | 5.6 | CTCCGCAAACGATTGCATCA | BF3147 |
| Bacteroides stercoris ATCC 43183 | ||||
|
Position: -404
Score: 5.8792 Sequence: ACATGCAATCGTTTGCACAA
Locus tag: BACSTE_01650
Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family
Locus tag: BACSTE_01649
Name: malP Funciton: Predicted maltose transporter, GPH family |
||||
| malR-malP | -404 | 5.9 | ACATGCAATCGTTTGCACAA | BACSTE_01650 |
| Bacteroides uniformis ATCC 8492 | ||||
|
Position: -127
Score: 5.71455 Sequence: GTCCGCAATCGTTTGCACAA
Locus tag: BACUNI_01203
Name: malR Funciton: Predicted maltose-responsive transcriptional regulator, LacI family
Locus tag: BACUNI_01202
Name: malP Funciton: Predicted maltose transporter, GPH family |
||||
| malR-malP | -127 | 5.7 | GTCCGCAATCGTTTGCACAA | BACUNI_01203 |