Orthologous regulated operons containing lldR gene
| Regulog: | LldR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Lactate utilization |
| Effector: | L-lactate |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -129
Score: 5.57022 Sequence: TCGGTAAAATACTTTGACCAT
Locus tag: Xaut_4351
Name: lldR Funciton: Lactate-responsive regulator LldR, GntR family |
||||
| lldR | -129 | 5.6 | TCGGTAAAATACTTTGACCAT | Xaut_4351 |