Orthologous regulated operons containing CAC3327 gene
| Regulog: | CymR - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Cysteine metabolism |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium acetobutylicum ATCC 824 | ||||
|
Position: -354
Score: 5.58509 Sequence: GTATACCTACTTGTATACTAGGAATAT
Locus tag: CAC3325
Name: CAC3325 Funciton: L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA
Locus tag: CAC3326
Name: CAC3326 Funciton: L-Cystine ABC transporter, permease protein TcyB
Locus tag: CAC3327
Name: CAC3327 Funciton: L-Cystine ABC transporter, ATP-binding protein TcyC |
||||
| CAC3325-CAC3326-CAC3327 | -354 | 5.6 | GTATACCTACTTGTATACTAGGAATAT | CAC3325 |