Orthologous regulated operons containing araG gene
| Regulog: | AraR - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium beijerincki NCIMB 8052 | ||||
|
Position: -310
Score: 4.40344 Sequence: CATGAAGTACGTACAACATA
Position: -135
Score: 4.41148 Sequence: ATTGATGTACTTACAAGATA
Locus tag: Cbei_4451
Name: Cbei_4451 Funciton: hypothetical protein
Locus tag: Cbei_4450
Name: araF Funciton: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
Locus tag: Cbei_4449
Name: araG Funciton: L-arabinose transport, ATP binding protein
Locus tag: Cbei_4448
Name: araH Funciton: L-arabinose transport system permease protein (TC 3.A.1.2.2) |
||||
| Cbei_4451-araF-araG-araH | -310 | 4.4 | CATGAAGTACGTACAACATA | Cbei_4451 |
| -135 | 4.4 | ATTGATGTACTTACAAGATA | ||