Orthologous regulated operons containing Cbei_4459 gene
| Regulog: | AraR - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium beijerincki NCIMB 8052 | ||||
|
Position: -52
Score: 4.9091 Sequence: GATGTGGTACGTACATGTTT
Locus tag: Cbei_4461
Name: Cbei_4461 Funciton: Putative arabinose-regulated ABC transport system, ATP-binding protein
Locus tag: Cbei_4460
Name: Cbei_4460 Funciton: Putative arabinose-regulated ABC transport system, permease protein
Locus tag: Cbei_4459
Name: Cbei_4459 Funciton: Putative arabinose-regulated ABC transport system, permease protein |
||||
| Cbei_4461-Cbei_4460-Cbei_4459 | -52 | 4.9 | GATGTGGTACGTACATGTTT | Cbei_4461 |