Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Cbei_4460 gene

Properties
Regulog: AraR - Clostridia-1
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium beijerincki NCIMB 8052
Position: -52
Score: 4.9091
Sequence: GATGTGGTACGTACATGTTT
Locus tag: Cbei_4461
Name: Cbei_4461
Funciton: Putative arabinose-regulated ABC transport system, ATP-binding protein
Locus tag: Cbei_4460
Name: Cbei_4460
Funciton: Putative arabinose-regulated ABC transport system, permease protein
Locus tag: Cbei_4459
Name: Cbei_4459
Funciton: Putative arabinose-regulated ABC transport system, permease protein
Cbei_4461-Cbei_4460-Cbei_4459 -52 4.9 GATGTGGTACGTACATGTTT Cbei_4461
© 2009-2020 RegPrecise