Orthologous regulated operons containing paaZ gene

Properties
Regulog:	PaaR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Proteobacteria/Beta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azoarcus sp. EbN1
Position: -150 Score: 5.49437 Sequence: TTTGACCGACCGGTCAATCAAT Locus tag: ebA3541 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: ebA3540 Name: paaY2 Funciton: Phenylacetic acid degradation protein PaaY
paaZ-paaY2	-150	5.5	TTTGACCGACCGGTCAATCAAT	ebA3541

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --