Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mce2A gene

Properties
Regulog: Mce2R - Mycobacteriaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Fatty acid metabolism
Effector:
Phylum: Actinobacteria
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Mycobacterium tuberculosis H37Rv
Position: -52
Score: 5.3435
Sequence: GGTGTCGGTCTGACCACTTGA
Locus tag: Rv0586
Name: mce2R
Funciton: Putative transcriptional regulator, GntR family
Locus tag: Rv0587
Name: yrbE2A
Funciton: hypothetical protein Rv0587
Locus tag: Rv0588
Name: yrbE2B
Funciton: hypothetical protein Rv0588
Locus tag: Rv0589
Name: mce2A
Funciton: MCE-family protein Mce2A
Locus tag: Rv0590
Name: mce2B
Funciton: virulence factor mce family protein
Locus tag: Rv0590A
Name: null
Funciton: MCE-FAMILY RELATED PROTEIN
Locus tag: Rv0591
Name: mce2C
Funciton: Virulence factor mce family protein
Locus tag: Rv0592
Name: mce2D
Funciton: virulence factor mce family protein
Locus tag: Rv0593
Name: lprL
Funciton: virulence factor Mce family protein
Locus tag: Rv0594
Name: mce2F
Funciton: virulence factor mce family protein
mce2R-yrbE2A-yrbE2B-mce2A-mce2B-Rv0590A-mce2C-mce2D-lprL-mce2F -52 5.3 GGTGTCGGTCTGACCACTTGA Rv0586