Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hsp20 gene

Properties
Regulog: Phr - Methanosarcinales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Methanosarcina acetivorans C2A
Position: -315
Score: 6.21732
Sequence: ATTGCTAACTAATGGTTACTAAC
Locus tag: MA4576
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: MA4575
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: MA4574
Name: hsp20
Funciton: Small heat shock protein 20
Locus tag: MA4573
Name: hsp20
Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20 -315 6.2 ATTGCTAACTAATGGTTACTAAC MA4576
Methanosarcina barkeri str. fusaro
Position: -189
Score: 5.90585
Sequence: GATGCTAACTATAGGTTACTATC
Locus tag: Mbar_A0909
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Mbar_A0908
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: Mbar_A0907
Name: hsp20
Funciton: Small heat shock protein 20
Locus tag: Mbar_A0906
Name: hsp20
Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20 -189 5.9 GATGCTAACTATAGGTTACTATC Mbar_A0909
Methanosarcina mazei Goe1
Position: -299
Score: 5.74626
Sequence: ACCGCTAACTAATGGTTACTAAC
Locus tag: MM1257
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: MM1256
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: MM1255
Name: hsp20
Funciton: Small heat shock protein 20
Locus tag: MM1254
Name: hsp20
Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20 -299 5.7 ACCGCTAACTAATGGTTACTAAC MM1257
© 2009-2020 RegPrecise