Orthologous regulated operons containing vat gene

Properties
Regulog:	Phr - Methanosarcinales
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Phylum:	Euryarchaeota

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Methanosaeta thermophila PT
Position: -56 Score: 5.52978 Sequence: ATATCTAACTTTTTGTTACTAAC Position: -42 Score: 4.99456 Sequence: GTTACTAACCATCAGTTATGATT Locus tag: Mthe_0612 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Mthe_0613 Name: vat Funciton: ATPase, AAA+ family
phr-vat	-56	5.5	ATATCTAACTTTTTGTTACTAAC	Mthe_0612
	-42	5	GTTACTAACCATCAGTTATGATT
Methanosarcina acetivorans C2A
Position: -315 Score: 6.21732 Sequence: ATTGCTAACTAATGGTTACTAAC Locus tag: MA4576 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: MA4575 Name: vat Funciton: ATPase, AAA+ family Locus tag: MA4574 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: MA4573 Name: hsp20 Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20	-315	6.2	ATTGCTAACTAATGGTTACTAAC	MA4576
Methanosarcina barkeri str. fusaro
Position: -189 Score: 5.90585 Sequence: GATGCTAACTATAGGTTACTATC Locus tag: Mbar_A0909 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Mbar_A0908 Name: vat Funciton: ATPase, AAA+ family Locus tag: Mbar_A0907 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: Mbar_A0906 Name: hsp20 Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20	-189	5.9	GATGCTAACTATAGGTTACTATC	Mbar_A0909
Methanosarcina mazei Goe1
Position: -299 Score: 5.74626 Sequence: ACCGCTAACTAATGGTTACTAAC Locus tag: MM1257 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: MM1256 Name: vat Funciton: ATPase, AAA+ family Locus tag: MM1255 Name: hsp20 Funciton: Small heat shock protein 20 Locus tag: MM1254 Name: hsp20 Funciton: Small heat shock protein 20
phr-vat-hsp20-hsp20	-299	5.7	ACCGCTAACTAATGGTTACTAAC	MM1257