Orthologous regulated operons containing btuD gene
| Regulog: | CblR - Thermoproteales |
| Regulator type: | Transcription factor |
| Regulator family: | |
| Regulation mode: | |
| Biological process: | Cobalamin biosynthesis |
| Effector: | |
| Phylum: | Crenarchaeota |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pyrobaculum calidifontis JCM 11548 | ||||
|
Position: -21
Score: 5.92645 Sequence: TATGGGATATTTCTCCCACA
Locus tag: Pcal_1519
Name: btuF Funciton: Vitamin B12 ABC transporter, B12-binding component BtuF
Locus tag: Pcal_1518
Name: btuC Funciton: Vitamin B12 ABC transporter, permease component BtuC
Locus tag: Pcal_1517
Name: btuD Funciton: Vitamin B12 ABC transporter, ATPase component BtuD |
||||
| btuF-btuC-btuD | -21 | 5.9 | TATGGGATATTTCTCCCACA | Pcal_1519 |