Orthologous regulated operons containing hisZ gene
Regulog: | HutC - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Cupriavidus taiwanensis | ||||
Position: -247
Score: 5.65278 Sequence: GATCCTGTCTATACAGCAAC
Position: -93
Score: 5.43936 Sequence: TGACTTGTATATACAGGCAT
Locus tag: RALTA_A2496
Name: hisX Funciton: Putative histidine ABC transporter, substrate binding protein
Locus tag: RALTA_A2495
Name: hisY Funciton: Putative histidine ABC transporter, permease protein
Locus tag: RALTA_A2494
Name: hisZ Funciton: Putative histidine ABC transporter, ATPase protein
Locus tag: RALTA_A2493
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisX-hisY-hisZ-hutC | -247 | 5.7 | GATCCTGTCTATACAGCAAC | RALTA_A2496 |
-93 | 5.4 | TGACTTGTATATACAGGCAT | ||
Ralstonia eutropha H16 | ||||
Position: -249
Score: 5.20991 Sequence: TGTCCTGTCTATACAGCAGC
Position: -93
Score: 5.60807 Sequence: TGACTTGTATATACAGGTAC
Locus tag: H16_A3022
Name: hisX Funciton: Putative histidine ABC transporter, substrate binding protein
Locus tag: H16_A3021
Name: hisY Funciton: Putative histidine ABC transporter, permease protein
Locus tag: H16_A3020
Name: hisZ Funciton: Putative histidine ABC transporter, ATPase protein
Locus tag: H16_A3019
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisX-hisY-hisZ-hutC | -249 | 5.2 | TGTCCTGTCTATACAGCAGC | H16_A3022 |
-93 | 5.6 | TGACTTGTATATACAGGTAC | ||
Ralstonia eutropha JMP134 | ||||
Position: -249
Score: 5.37126 Sequence: ACTCCTGTCTATACAGCAAC
Position: -94
Score: 5.67179 Sequence: TGACTTGTATATACAGGATT
Locus tag: Reut_A2720
Name: hisX Funciton: Putative histidine ABC transporter, substrate binding protein
Locus tag: Reut_A2719
Name: hisY Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Reut_A2718
Name: hisZ Funciton: Putative histidine ABC transporter, ATPase protein
Locus tag: Reut_A2717
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisX-hisY-hisZ-hutC | -249 | 5.4 | ACTCCTGTCTATACAGCAAC | Reut_A2720 |
-94 | 5.7 | TGACTTGTATATACAGGATT | ||
Ralstonia metallidurans CH34 | ||||
Position: -271
Score: 5.83693 Sequence: CTTGTTGTATATACAGCAAT
Position: -114
Score: 5.21767 Sequence: TGACTTGTATATACAGCGTT
Locus tag: Rmet_2859
Name: hisX Funciton: Putative histidine ABC transporter, substrate binding protein
Locus tag: Rmet_2858
Name: hisY Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Rmet_2857
Name: hisZ Funciton: Putative histidine ABC transporter, ATPase protein
Locus tag: Rmet_2856
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisX-hisY-hisZ-hutC | -271 | 5.8 | CTTGTTGTATATACAGCAAT | Rmet_2859 |
-114 | 5.2 | TGACTTGTATATACAGCGTT |