Orthologous regulated operons containing hutH2 gene
Regulog: | HutC - Burkholderia |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Burkholderia glumae BGR1 | ||||
Position: -72
Score: 5.49837 Sequence: ATTCTTGTCTATACAAGATC
Locus tag: bglu_1g18060
Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: bglu_1g18050
Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: bglu_1g18040
Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: bglu_1g18030
Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Locus tag: bglu_1g18020
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: bglu_1g18010
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisJ2-hisQ2-hisM2-hisP2-hutH2-hutC | -72 | 5.5 | ATTCTTGTCTATACAAGATC | bglu_1g18060 |
Burkholderia phymatum STM815 | ||||
Position: -218
Score: 4.26156 Sequence: GAACATGTCTAGTCAGCTGC
Position: -66
Score: 5.10467 Sequence: AGACTTGTCTATACATGTCC
Locus tag: Bphy_5100
Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bphy_5101
Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bphy_5102
Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bphy_5103
Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Locus tag: Bphy_5104
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bphy_5105
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisJ2-hisQ2-hisM2-hisP2-hutH2-hutC | -218 | 4.3 | GAACATGTCTAGTCAGCTGC | Bphy_5100 |
-66 | 5.1 | AGACTTGTCTATACATGTCC | ||
Burkholderia vietnamiensis G4 | ||||
Position: -235
Score: 4.25366 Sequence: AAATTTGTCTAGTCATCCTG
Position: -75
Score: 5.11355 Sequence: ATGCTTGTATAGACAAATTC
Locus tag: Bcep1808_5569
Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bcep1808_5570
Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bcep1808_5571
Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bcep1808_5572
Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Locus tag: Bcep1808_5573
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bcep1808_5574
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisJ2-hisQ2-hisM2-hisP2-hutH2-hutC | -235 | 4.3 | AAATTTGTCTAGTCATCCTG | Bcep1808_5569 |
-75 | 5.1 | ATGCTTGTATAGACAAATTC | ||
Burkholderia xenovorans LB400 | ||||
Position: -240
Score: 5.10281 Sequence: CAACCTGTCTAGACAAAACA
Position: -67
Score: 5.32708 Sequence: AGACTTGTCTATACAAATTA
Locus tag: Bxe_B1829
Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bxe_B1828
Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bxe_B1827
Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bxe_B1826
Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Locus tag: Bxe_B1825
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bxe_B1824
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
hisJ2-hisQ2-hisM2-hisP2-hutH2-hutC | -240 | 5.1 | CAACCTGTCTAGACAAAACA | Bxe_B1829 |
-67 | 5.3 | AGACTTGTCTATACAAATTA |