Orthologous regulated operons containing COG1457 (CodB) gene
| Regulog: | HutC - Burkholderia |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Burkholderia cepacia AMMD | ||||
|
Position: -150
Score: 5.65859 Sequence: CAAGTTGTATATACAAGAAT
Locus tag: Bamb_1129
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -150 | 5.7 | CAAGTTGTATATACAAGAAT | Bamb_1129 |
| Burkholderia mallei ATCC 23344 | ||||
|
Position: -71
Score: 5.09292 Sequence: ACAGTTGTCTATACAATTTT
Locus tag: BMAA0417
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -71 | 5.1 | ACAGTTGTCTATACAATTTT | BMAA0417 |
| Burkholderia pseudomallei K96243 | ||||
|
Position: -71
Score: 5.09292 Sequence: ACAGTTGTCTATACAATTTT
Locus tag: BPSS1752
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -71 | 5.1 | ACAGTTGTCTATACAATTTT | BPSS1752 |
| Burkholderia sp. 383 | ||||
|
Position: -196
Score: 5.88288 Sequence: CAAGTTGTATATACAAGATC
Locus tag: Bcep18194_A4383
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -196 | 5.9 | CAAGTTGTATATACAAGATC | Bcep18194_A4383 |
| Burkholderia vietnamiensis G4 | ||||
|
Position: -169
Score: 5.45042 Sequence: CTAGTTGTATATACAACAAT
Locus tag: Bcep1808_1206
Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
||||
| COG1457 (CodB) | -169 | 5.5 | CTAGTTGTATATACAACAAT | Bcep1808_1206 |