Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hisT gene

Properties
Regulog: HutC - Comamonadaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Delftia acidovorans SPH-1
Position: -449
Score: 5.15069
Sequence: CATATTGTATATACAGGCTT
Locus tag: Daci_0094
Name: hisT
Funciton: Histidine transport protein (permease)
hisT -449 5.2 CATATTGTATATACAGGCTT Daci_0094