Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing COG1174 (OpuBB) gene

Properties
Regulog: HutC - Comamonadaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Polaromonas sp. JS666
Position: -158
Score: 5.26867
Sequence: TCGCTTGTATATACAAGTTG
Locus tag: Bpro_1158
Name: COG1732 (OpuBC)
Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain
Locus tag: Bpro_1157
Name: hutH2
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1156
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1155
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1154
Name: COG1125 (OpuBA)
Funciton: ABC proline/glycine/betaine transporter, ATPase component
COG1732 (OpuBC)-hutH2-COG1174 (OpuBB)-COG1174 (OpuBB)-COG1125 (OpuBA) -158 5.3 TCGCTTGTATATACAAGTTG Bpro_1158
© 2009-2020 RegPrecise