Orthologous regulated operons containing COG1732 (OpuBC) gene
| Regulog: | HutC - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Polaromonas sp. JS666 | ||||
|
Position: -158
Score: 5.26867 Sequence: TCGCTTGTATATACAAGTTG
Locus tag: Bpro_1158
Name: COG1732 (OpuBC) Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain
Locus tag: Bpro_1157
Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1156
Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1155
Name: COG1174 (OpuBB) Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1154
Name: COG1125 (OpuBA) Funciton: ABC proline/glycine/betaine transporter, ATPase component |
||||
| COG1732 (OpuBC)-hutH2-COG1174 (OpuBB)-COG1174 (OpuBB)-COG1125 (OpuBA) | -158 | 5.3 | TCGCTTGTATATACAAGTTG | Bpro_1158 |