Orthologous regulated operons containing hisC gene
| Regulog: | HutC - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Delftia acidovorans SPH-1 | ||||
|
Position: -67
Score: 4.86688 Sequence: GATATTGTATAGACAGGCAT
Locus tag: Daci_0149
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Daci_0150
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Daci_0151
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Daci_0152
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Daci_0153
Name: COG277 (GlcD) Funciton: FAD linked oxidase domain protein
Locus tag: Daci_0154
Name: hisC Funciton: Histidinol-phosphate aminotransferase
Locus tag: Daci_0155
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Daci_0156
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) |
||||
| hutH-hutU-hutD-hutI-COG277 (GlcD)-hisC-hutF-hutG | -67 | 4.9 | GATATTGTATAGACAGGCAT | Daci_0149 |