Orthologous regulated operons containing COG5285 gene

Properties
Regulog:	HutC - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Phylum:	Proteobacteria/beta

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -102 Score: 5.63605 Sequence: CAGCCTGTATATACAAGTTG Position: -24 Score: 5.2384 Sequence: TGACTTGTATATACAGGAAA Locus tag: Aave_2965 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Aave_2964 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Aave_2963 Name: COG5285 Funciton: Phytanoyl-CoA dioxygenase Locus tag: Aave_2962 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Aave_2961 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Aave_2960 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: Aave_2959 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
hutH-hutU-COG5285-hutD-hutI-hutF-hutG	-102	5.6	CAGCCTGTATATACAAGTTG	Aave_2965
	-24	5.2	TGACTTGTATATACAGGAAA
Polaromonas sp. JS666
Position: -25 Score: 5.57679 Sequence: CAACTTGTATATACAGGACT Locus tag: Bpro_1043 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Bpro_1042 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Bpro_1041 Name: COG1414 Funciton: Transcriptional regulator, IclR family Locus tag: Bpro_1040 Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein Locus tag: Bpro_1039 Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component Locus tag: Bpro_1038 Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component Locus tag: Bpro_1037 Name: COG5285 Funciton: Phytanoyl-CoA dioxygenase Locus tag: Bpro_1036 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Bpro_1035 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Bpro_1034 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutH-hutU-COG1414-COG834 (HisJ)-COG765 (HisM)-COG1126 (GlnQ)-COG5285-hutD-hutI-hutF	-25	5.6	CAACTTGTATATACAGGACT	Bpro_1043