Orthologous regulated operons containing COG1126 (GlnQ) gene
| Regulog: | HutC - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Polaromonas sp. JS666 | ||||
|
Position: -25
Score: 5.57679 Sequence: CAACTTGTATATACAGGACT
Locus tag: Bpro_1043
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1042
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Bpro_1041
Name: COG1414 Funciton: Transcriptional regulator, IclR family
Locus tag: Bpro_1040
Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Bpro_1039
Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component
Locus tag: Bpro_1038
Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component
Locus tag: Bpro_1037
Name: COG5285 Funciton: Phytanoyl-CoA dioxygenase
Locus tag: Bpro_1036
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Bpro_1035
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Bpro_1034
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
||||
| hutH-hutU-COG1414-COG834 (HisJ)-COG765 (HisM)-COG1126 (GlnQ)-COG5285-hutD-hutI-hutF | -25 | 5.6 | CAACTTGTATATACAGGACT | Bpro_1043 |
| Rhodoferax ferrireducens DSM 15236 | ||||
|
Position: -221
Score: 5.82782 Sequence: AAAGTTGTCTATACAACTTA
Locus tag: Rfer_4161
Name: COG1414 Funciton: Transcriptional regulator, IclR family
Locus tag: Rfer_4160
Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Rfer_4159
Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component
Locus tag: Rfer_4158
Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component
Locus tag: Rfer_4157
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: Rfer_4156
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Rfer_4155
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
Locus tag: Rfer_4154
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
||||
| COG1414-COG834 (HisJ)-COG765 (HisM)-COG1126 (GlnQ)-hutC-hutD-hutG-hutF | -221 | 5.8 | AAAGTTGTCTATACAACTTA | Rfer_4161 |