Orthologous regulated operons containing hutF gene
| Regulog: | HutC - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||||
|
Position: -102
Score: 5.63605 Sequence: CAGCCTGTATATACAAGTTG
Position: -24
Score: 5.2384 Sequence: TGACTTGTATATACAGGAAA
Locus tag: Aave_2965
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Aave_2964
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Aave_2963
Name: COG5285 Funciton: Phytanoyl-CoA dioxygenase
Locus tag: Aave_2962
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Aave_2961
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Aave_2960
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Aave_2959
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) |
||||
| hutH-hutU-COG5285-hutD-hutI-hutF-hutG | -102 | 5.6 | CAGCCTGTATATACAAGTTG | Aave_2965 |
| -24 | 5.2 | TGACTTGTATATACAGGAAA | ||
| Delftia acidovorans SPH-1 | ||||
|
Position: -67
Score: 4.86688 Sequence: GATATTGTATAGACAGGCAT
Locus tag: Daci_0149
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Daci_0150
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Daci_0151
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Daci_0152
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Daci_0153
Name: COG277 (GlcD) Funciton: FAD linked oxidase domain protein
Locus tag: Daci_0154
Name: hisC Funciton: Histidinol-phosphate aminotransferase
Locus tag: Daci_0155
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Daci_0156
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) |
||||
| hutH-hutU-hutD-hutI-COG277 (GlcD)-hisC-hutF-hutG | -67 | 4.9 | GATATTGTATAGACAGGCAT | Daci_0149 |
| Polaromonas sp. JS666 | ||||
|
Position: -25
Score: 5.57679 Sequence: CAACTTGTATATACAGGACT
Locus tag: Bpro_1043
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1042
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Bpro_1041
Name: COG1414 Funciton: Transcriptional regulator, IclR family
Locus tag: Bpro_1040
Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Bpro_1039
Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component
Locus tag: Bpro_1038
Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component
Locus tag: Bpro_1037
Name: COG5285 Funciton: Phytanoyl-CoA dioxygenase
Locus tag: Bpro_1036
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Bpro_1035
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Bpro_1034
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
||||
| hutH-hutU-COG1414-COG834 (HisJ)-COG765 (HisM)-COG1126 (GlnQ)-COG5285-hutD-hutI-hutF | -25 | 5.6 | CAACTTGTATATACAGGACT | Bpro_1043 |
| Rhodoferax ferrireducens DSM 15236 | ||||
|
Position: -221
Score: 5.82782 Sequence: AAAGTTGTCTATACAACTTA
Locus tag: Rfer_4161
Name: COG1414 Funciton: Transcriptional regulator, IclR family
Locus tag: Rfer_4160
Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Rfer_4159
Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component
Locus tag: Rfer_4158
Name: COG1126 (GlnQ) Funciton: ABC amino acid transporter, ATPase component
Locus tag: Rfer_4157
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: Rfer_4156
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Rfer_4155
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
Locus tag: Rfer_4154
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
||||
| COG1414-COG834 (HisJ)-COG765 (HisM)-COG1126 (GlnQ)-hutC-hutD-hutG-hutF | -221 | 5.8 | AAAGTTGTCTATACAACTTA | Rfer_4161 |
| Variovorax paradoxus S110 | ||||
|
Position: -22
Score: 5.57762 Sequence: CTACTTGTATAGACAGGTTC
Locus tag: Vapar_0158
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Vapar_0159
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Vapar_0160
Name: COG1414 Funciton: Transcriptional regulator, IclR family
Locus tag: Vapar_0161
Name: COG834 (HisJ) Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Vapar_0162
Name: COG765 (HisM) Funciton: ABC amino acid transporter, permease component
Locus tag: Vapar_0163
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Vapar_0164
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Vapar_0165
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Vapar_0166
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) |
||||
| hutH-hutU-COG1414-COG834 (HisJ)-COG765 (HisM)-hutD-hutI-hutF-hutG | -22 | 5.6 | CTACTTGTATAGACAGGTTC | Vapar_0158 |
| Verminephrobacter eiseniae EF01-2 | ||||
|
Position: -100
Score: 5.35556 Sequence: CAACCTGTATAGACAGGAAT
Locus tag: Veis_3641
Name: hisX Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: Veis_3642
Name: hisY Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Veis_3643
Name: hisZ Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: Veis_3644
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: Veis_3645
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Veis_3646
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Veis_3647
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Veis_3648
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Veis_3649
Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Veis_3650
Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68) |
||||
| hisX-hisY-hisZ-hutC-hutH-hutU-hutD-hutI-hutF-hutG | -100 | 5.4 | CAACCTGTATAGACAGGAAT | Veis_3641 |