Orthologous regulated operons containing hisT gene
| Regulog: | HutC - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -90
Score: 5.62135 Sequence: ATGGATGTATATACAAGTTA
Locus tag: AB57_3860
Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: AB57_3859
Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: AB57_3858
Name: hisT Funciton: Histidine transport protein (permease)
Locus tag: AB57_3857
Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: AB57_3856
Name: hutG2 Funciton: Formiminoglutamase (EC 3.5.3.8) |
||||
| hutU-hutH-hisT-hutI-hutG2 | -90 | 5.6 | ATGGATGTATATACAAGTTA | AB57_3860 |