Orthologous regulated operons containing hutC gene
| Regulog: | HutC - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Psychrobacter sp. PRwf-1 | ||||
|
Position: -156
Score: 4.99599 Sequence: GATTTTGTATATACAAATTA
Locus tag: PsycPRwf_0853
Name: hutC Funciton: Histidine utilization repressor, GntR family |
||||
| hutC | -156 | 5 | GATTTTGTATATACAAATTA | PsycPRwf_0853 |